West Coast Green Crab Experiment Part 84
Troubleshooting script issues (part 2)
2026-01-16
I started running the script on Dec. 31, but then there was a node failure and my script was restarted by IS. I got an email last night saying that my job failed! I started by looking at the error log:
(base) [yaamini.venkataraman@poseidon-l1 ~]$ tail /vortexfs1/scratch/yaamini.venkataraman/wc-green-crab/output/06c-trinity/yrv_trinity1816194.log [Fri Jan 16 01:43:23 2026] Running CMD: /vortexfs1/home/yaamini.venkataraman/.conda/envs/trinity_env/bin/util/support_scripts/filter_transcripts_require_min_cov.pl Trinity.tmp.fasta /scratch/yaamini.venkataraman/wc-green-crab/output/06c-trinity/trinity_out_dir/both.fa salmon_outdir/quant.sf 2 > /scratch/yaamini.venkataraman/wc-green-crab/output/06c-trinity/trinity_out_dir.Trinity.fasta Friday, January 16, 2026: 01:44:19 CMD: /vortexfs1/home/yaamini.venkataraman/.conda/envs/trinity_env/bin/util/support_scripts/get_Trinity_gene_to_trans_map.pl /scratch/yaamini.venkataraman/wc-green-crab/output/06c-trinity/trinity_out_dir.Trinity.fasta > /scratch/yaamini.venkataraman/wc-green-crab/output/06c-trinity/trinity_out_dir.Trinity.fasta.gene_trans_map ############################################################################# Finished. Final Trinity assemblies are written to /scratch/yaamini.venkataraman/wc-green-crab/output/06c-trinity/trinity_out_dir.Trinity.fasta ############################################################################# Error: Couldn’t open /vortexfs1/scratch/yaamini.venkataraman/wc-green-crab/output/06c-trinity/trinity_out_dir/Trinity.fasta
Looks like the transcriptome was written! However, it was written to the wrong place (again…yikes). The file path for the transcriptome is /scratch/yaamini.venkataraman/wc-green-crab/output/06c-trinity/trinity_out_dir.Trinity.fasta but trinity was looking for the transcriptome in /vortexfs1/scratch/yaamini.venkataraman/wc-green-crab/output/06c-trinity/trinity_out_dir/Trinity.fasta. I first checked whether or not that transcriptome file even existed.
(base) [yaamini.venkataraman@poseidon-l1 06c-trinity]$ head trinity_out_dir.Trinity.fasta TRINITY_DN0_c0_g1_i11 len=236 path=[2:0-27 3:28-31 4:32-95 5:96-109 8:110-111 10:112-122 11:123-134 12:135-158 14:159-159 29:160-161 32:162-163 33:164-202 35:203-235] GCGCTGGAGGGCGCCGTGGTCATCCGTTTAGTAGCCGCTGGAGGGCGCCATGGTCATCCT TAAAAGCAGGTCCTGGAGGGCGCCATGGTCATCCGTGTAGTAGGCGCTGGATGGCGCCGT GGTCATCCGTGTAGTATGTGCTGGAGAGCGCCATGGTCAGCCATAAAAGCAGGTCCTGGA GGGCGCCGTGGTCATCCGTGTAGTAGATGCTGGAGGGCGCCATGGTCATCCGTGTA TRINITY_DN0_c0_g1_i12 len=274 path=[4:0-63 6:64-78 9:79-79 10:80-90 11:91-102 12:103-126 13:127-131 16:132-138 17:139-139 20:140-140 21:141-172 22:173-181 24:182-183 25:184-215 26:216-216 28:217-230 29:231-232 32:233-234 33:235-273] AGCCGCTGGAGGGCGCCATGGTCATCCTTAAAAGCAGGTCCTGGAGGGCGCCATGGTCAT CCGTTTAGTAGGCGCTGAAGGGCGCCGTGGTCATCCGTGTAGTATGTGCTGGAGAGCGCC ATGGTCATCCATAAAAGCAGGTCCTGGAGGGCGCCGTGATCATCCGTGTAGTAGGCGCTG GAGTGCGCCATGGTCATCCGTGTAGTAGGCGCTGGATGGCGCCATGGTCATCCATAAAAG
SHE EXISTS! I HAVE A TRANSCRIPTOME! There was another file that looks like a gene-isoform map as well:
(base) [yaamini.venkataraman@poseidon-l1 06c-trinity]$ head trinity_out_dir.Trinity.fasta.gene_trans_map TRINITY_DN0_c0_g1 TRINITY_DN0_c0_g1_i11 TRINITY_DN0_c0_g1 TRINITY_DN0_c0_g1_i12 TRINITY_DN0_c0_g1 TRINITY_DN0_c0_g1_i13 TRINITY_DN0_c0_g1 TRINITY_DN0_c0_g1_i2 TRINITY_DN0_c0_g1 TRINITY_DN0_c0_g1_i4 TRINITY_DN0_c0_g1 TRINITY_DN0_c0_g1_i5 TRINITY_DN0_c0_g1 TRINITY_DN0_c0_g1_i6 TRINITY_DN0_c0_g1 TRINITY_DN0_c0_g1_i7 TRINITY_DN0_c0_g1 TRINITY_DN0_c0_g1_i8 TRINITY_DN0_c0_g1 TRINITY_DN0_c0_g1_i9
Now I had a couple of issues:
- Rename the transcriptome and gene map files to be consistent with what the script expects
- Fix any file paths in the script to ensure that if this script was run again, I wouldn’t end up with the same issues
- Figure out how to continue with the
trinityworkflow
I used mv to move and rename the files:
(base) [yaamini.venkataraman@poseidon-l1 06c-trinity]$ mv trinity_out_dir.Trinity.fasta trinity_out_dir/Trinity.fasta
(base) [yaamini.venkataraman@poseidon-l1 06c-trinity]$ mv trinity_out_dir.Trinity.fasta.gene_trans_map trinity_out_dir/Trinity.fasta.gene_trans_map
For the second point, I’m actually not sure what governs the file path distinction, since I already have all of my paths listed:
#Program paths
TRINITY=/vortexfs1/home/yaamini.venkataraman/.conda/envs/trinity_env/bin/
CUTADAPT=/vortexfs1/home/yaamini.venkataraman/.conda/envs/trinity_env/bin/cutadapt
FASTQC=/vortexfs1/home/yaamini.venkataraman/.conda/envs/trinity_env/bin/fastqc
python=/vortexfs1/home/yaamini.venkataraman/.conda/envs/trinity_env/bin/python
JELLYFISH=//vortexfs1/home/yaamini.venkataraman/.conda/envs/trinity_env/bin/jellyfish
SALMON=/vortexfs1/home/yaamini.venkataraman/.conda/envs/trinity_env/bin/salmon
SAMTOOLS=/vortexfs1/home/yaamini.venkataraman/.conda/envs/trinity_env/bin/samtools
#Directory and file paths
DATA_DIR=/vortexfs1/scratch/yaamini.venkataraman/wc-green-crab/output/06b-trimgalore/trim-illumina-polyA
OUTPUT_DIR=/vortexfs1/scratch/yaamini.venkataraman/wc-green-crab/output/06c-trinity
assembly_stats=assembly_stats.txt
trinity_file_list=/vortexfs1/home/yaamini.venkataraman/trinity-samples.txt
I did a quick Google search and found this page, which says trinity will create a trinity_out_dir.Trinity.fasta output file by default. If I supply a prefix, it may write the file to a different location. Since this is the default behavior, I decided to add a line of code to the script to move the transcriptome to the correct directory for future steps:
# Run Trinity to assemble de novo transcriptome. Using primarily default parameters.
${TRINITY}/Trinity \
--seqType fq \
--max_memory 100G \
--samples_file ${trinity_file_list} \
--SS_lib_type RF \
--min_contig_length 200 \
--full_cleanup \
--CPU 28
# Move transcriptome to the correct location
mv trinity_out_dir.Trinity.fasta trinity_out_dir/Trinity.fasta
Now to figure out how to move forward. The transcriptome existing means that trinity is finished! So the error must have come from the subsequent sections. I think the issue is that a perl script meant to get assembly statistics couldn’t find the transcriptome! I confirmed this by the fact that the output assembly statistics file is empty, but was created shortly before the script failed. I restarted the script to run just the assembly statistics parts:
# Assembly stats
${TRINITY}/util/TrinityStats.pl \
${OUTPUT_DIR}/trinity_out_dir/Trinity.fasta \
> ${assembly_stats}
# Create gene map files
${TRINITY}/util/support_scripts/get_Trinity_gene_to_trans_map.pl \
${OUTPUT_DIR}/trinity_out_dir/Trinity.fasta \
> ${OUTPUT_DIR}/trinity_out_dir/Trinity.fasta.gene_trans_map
2026-01-20
I got the assembly statistics information and a revised gene map! I moved the transcriptome, assembly stats, and gene map to my home directory to avoid any fishy cluster business. I also moved the assembly stats and gene map to this repository folder.
I then took a look at the assembly statistics:
################################
## Counts of transcripts, etc.
################################
Total trinity 'genes': 648340
Total trinity transcripts: 913680
Percent GC: 43.38
########################################
Stats based on ALL transcript contigs:
########################################
Contig N10: 3987
Contig N20: 2408
Contig N30: 1530
Contig N40: 1009
Contig N50: 699
Median contig length: 327
Average contig: 555.10
Total assembled bases: 507186700
#####################################################
## Stats based on ONLY LONGEST ISOFORM per 'GENE':
#####################################################
Contig N10: 2696
Contig N20: 1423
Contig N30: 903
Contig N40: 641
Contig N50: 488
Median contig length: 300
Average contig: 454.68
Total assembled bases: 294789897
I need to understand if this is pretty common. The median contig length is quite short, around ~300 bp. I used a 200 bp minimum contig length. The N50 is 699, which means that half of the nucleotides in the transcriptome are at least 699 bp long. However, there can be some issue when translating N50 to transcriptome data, as it is meant for genomes. I need to get the Ex50 (N50 for transcripts that constitute 90% of the total expression) information instead, which means I will need to look at Zac’s scripts to figure out how to do that. There are also some tools listed on the trinity wiki for understanding assembly quality.
I decided to start by comparing my assembly to the one in Tepolt et al. (2015). The initial assembly was created with CLC workbench, not trinity, and it was done over 10 years ago, so a direct comparison probably isn’t the easiest. However, Tepolt et al. reported 117,189 contigs with an N50 of 1016. This means that their assembly had fewer contigs, but they were much longer. I compared my assembly to Zac’s as well, since he used similar methods. He reported 146,332 contigs with an average contig length of 577 bp and a total N50 of 774 bp. The average contig length and N50 are pretty comparable to my assembly. I just have way more contigs, but I think that’s pretty standard for the dumpster fire that is the green crab genome.
2026-01-21
My task today was to figure out how to move forward with getting assembly statistics. The main thing I want to do is get ExN50, since that’s a better metric of transcriptome assembly quality than the N50 provided by trinity. I first looked at my script and realized there were a couple of things I missed from Grace’s script within the assembly-adjacent steps!
# Create sequence lengths file (used for differential gene expression)
${TRINITY}/util/misc/fasta_seq_length.pl \
${OUTPUT_DIR}/trinity_out_dir/Trinity.fasta \
> ${OUTPUT_DIR}/trinity_out_dir/Trinity.fasta.seq_lens
# Create FastA index
${SAMTOOLS} faidx \
${OUTPUT_DIR}/trinity_out_dir/Trinity.fasta
I ran these two pieces of code.
(base) [yaamini.venkataraman@poseidon-l2 trinity_out_dir]$ head Trinity.fasta.seq_lens fasta_entry length TRINITY_DN0_c0_g1_i11 236 TRINITY_DN0_c0_g1_i12 274 TRINITY_DN0_c0_g1_i13 221 TRINITY_DN0_c0_g1_i2 274 TRINITY_DN0_c0_g1_i4 243 TRINITY_DN0_c0_g1_i5 227 TRINITY_DN0_c0_g1_i6 294 TRINITY_DN0_c0_g1_i7 252 TRINITY_DN0_c0_g1_i8 380
(base) [yaamini.venkataraman@poseidon-l2 trinity_out_dir]$ head Trinity.fasta.fai TRINITY_DN0_c0_g1_i11 236 168 60 61 TRINITY_DN0_c0_g1_i12 274 642 60 61 TRINITY_DN0_c0_g1_i13 221 1091 60 61 TRINITY_DN0_c0_g1_i2 274 1557 60 61 TRINITY_DN0_c0_g1_i4 243 2049 60 61 TRINITY_DN0_c0_g1_i5 227 2433 60 61 TRINITY_DN0_c0_g1_i6 294 2866 60 61 TRINITY_DN0_c0_g1_i7 252 3360 60 61 TRINITY_DN0_c0_g1_i8 380 3874 60 61 TRINITY_DN0_c0_g1_i9 355 4518 60 61
I also moved these files to my home directory on and to this repository folder. I then reviewed the methods section of Zac’s manuscript. It seems like he was able to get ExN50 information from within trinity. I returned to that very helpful Assembly Quality Assessment page and followed this link to information for Ex50 statistics. Looks like there is a perl script for Ex50 calculation, but I need to perform transcript abundance estimation first. Once again, the trinity wiki had a page all about it (side note: this is an extremely helpful manual we love reproducibility).
I think the workflow is to:
- Prepare the reference
- Run abundance estimation with
salmonwithintrinity(no need to build transcript or gene expression matrices until I need to startDESeq2) - Calculate Ex50 statistics within
trinity
The important part of Zac’s snakemake code seems to start here. He prepared the reference with salmon because he wanted to pass kmer options to the salmon index, but I don’t know how necessary that is for me since I haven’t iterated on multiple different kmer parameters like he has. I think I could use the default trinity method of preparing the reference with bowtie2 within trinity. I will follow the trinity recommendation to run this in two separate coding steps, as opposed to doing all of it in one coding step:
# Prepare the reference (target index) with bowtie2 prior to transcript abundance estimation. The output is a BAM file necessary for pseudo-alignment
${TRINITY}/util/align_and_estimate_abundance.pl \
--transcripts ${OUTPUT_DIR}/trinity_out_dir/Trinity.fasta \
--est_method salmon \
--aln_method bowtie2 \
--gene_trans_map ${OUTPUT_DIR}/trinity_out_dir/Trinity.fasta.gene_trans_map \
--prep_reference \
--coordsort_bam
# Perform transcript abundance estimation with salmon
${TRINITY}/util/align_and_estimate_abundance.pl \
--transcripts ${OUTPUT_DIR}/trinity_out_dir/Trinity.fasta \
--seqType fq \
--samples_file ${trinity_file_list} \
--SS_lib_type RF \
--est_method salmon \
--aln_method bowtie2 \
--gene_trans_map ${OUTPUT_DIR}/trinity_out_dir/Trinity.fasta.gene_trans_map \
--output_dir ${OUTPUT_DIR} \
--salmon_add_opts "--validateMappings " \
--thread_count 16
The bowtie2 part was done based on the trinity manual, while I added some arguments from Zac’s code to the salmon part. I also noticed that bowtie2 was not included in my path list. I need to see if I even have bowtie2!
(base) [yaamini.venkataraman@poseidon-l2 ~]$ conda activate trinity_env (trinity_env) [yaamini.venkataraman@poseidon-l2 ~]$ which bowtie2 ~/.conda/envs/trinity_env/bin/bowtie2
I have bowtie2 installed in my conda environment, so I went ahead and added that to my path list. I then started the script.
2026-01-26
My script stopped 3 minutes after I started it =____= I went into the error log to try and figure out what happened.
The first stage was to build an index with salmon:
[2026-01-21 15:53:48.900] [jLog] [info] building index out : /vortexfs1/scratch/yaamini.venkataraman/wc-green-crab/output/06c-trinity/trinity_out_dir/Trinity.fasta.salmon.idx
salmon then started running fixFasta to produce an output file: /vortexfs1/scratch/yaamini.venkataraman/wc-green-crab/output/06c-trinity/trinity_out_dir/Trinity.fasta.salmon.idx/ref_k31_fixed.fa After that, it started building another index with Pufferfish (?) and I saw a lot of Building BooPHF log comments. I then got some confirmation that the denser index was completed:
[2026-01-21 15:57:01.926] [puff::index::jointLog] [info] mphf size = 158.513 MB [2026-01-21 15:57:02.154] [puff::index::jointLog] [info] chunk size = 93,110,908 [2026-01-21 15:57:02.154] [puff::index::jointLog] [info] chunk 0 = [0, 93,110,908) [2026-01-21 15:57:02.154] [puff::index::jointLog] [info] chunk 1 = [93,110,908, 186,221,816) [2026-01-21 15:57:02.154] [puff::index::jointLog] [info] chunk 2 = [186,221,816, 279,332,724) [2026-01-21 15:57:02.154] [puff::index::jointLog] [info] chunk 3 = [279,332,724, 372,443,600) [2026-01-21 15:57:21.031] [puff::index::jointLog] [info] finished populating pos vector [2026-01-21 15:57:21.034] [puff::index::jointLog] [info] writing index components [2026-01-21 15:57:24.222] [puff::index::jointLog] [info] finished writing dense pufferfish index [2026-01-21 15:57:24.392] [jLog] [info] done building index for info, total work write each : 2.331 total work inram from level 3 : 4.322 total work raw : 25.000 Bitarray 1329704000 bits (100.00 %) (array + ranks ) final hash 0 bits (0.00 %) (nb in final hash 0)
Alright, so that fist indexing step must have finished! According to my code, there should be a BAM file output:
(base) [yaamini.venkataraman@poseidon-l2 Trinity.fasta.salmon.idx]$ ls -la total 1519483 drwxrwxr-x 2 yaamini.venkataraman domain users 4096 Jan 21 15:57 . drwxrwxr-x 2 yaamini.venkataraman domain users 4096 Jan 21 15:53 .. -rw-rw-r– 1 yaamini.venkataraman domain users 3654728 Jan 21 15:54 complete_ref_lens.bin -rw-rw-r– 1 yaamini.venkataraman domain users 176373690 Jan 21 15:56 ctable.bin -rw-rw-r– 1 yaamini.venkataraman domain users 12361376 Jan 21 15:56 ctg_offsets.bin -rw-rw-r– 1 yaamini.venkataraman domain users 25 Jan 21 15:54 duplicate_clusters.tsv -rw-rw-r– 1 yaamini.venkataraman domain users 1104 Jan 21 15:57 info.json -rw-rw-r– 1 yaamini.venkataraman domain users 166213436 Jan 21 15:57 mphf.bin -rw-rw-r– 1 yaamini.venkataraman domain users 919933544 Jan 21 15:57 pos.bin -rw-rw-r– 1 yaamini.venkataraman domain users 496 Jan 21 15:57 pre_indexing.log -rw-rw-r– 1 yaamini.venkataraman domain users 46555488 Jan 21 15:56 rank.bin -rw-rw-r– 1 yaamini.venkataraman domain users 7309448 Jan 21 15:56 refAccumLengths.bin -rw-rw-r– 1 yaamini.venkataraman domain users 2971 Jan 21 15:57 ref_indexing.log -rw-rw-r– 1 yaamini.venkataraman domain users 3654728 Jan 21 15:56 reflengths.bin -rw-rw-r– 1 yaamini.venkataraman domain users 126774056 Jan 21 15:56 refseq.bin -rw-rw-r– 1 yaamini.venkataraman domain users 93110944 Jan 21 15:56 seq.bin -rw-rw-r– 1 yaamini.venkataraman domain users 127 Jan 21 15:57 versionInfo.json
Since the indexing finished, perhaps it’s just a different filetype than I expected. The script proceeded and I got a bunch of the same error, repeated for each file:
CMD: salmon quant -i /vortexfs1/scratch/yaamini.venkataraman/wc-green-crab/output/06c-trinity/trinity_out_dir/Trinity.fasta.salmon.idx -l ISR -1 /vortexfs1/scratch/yaamini.venkataraman/wc-green-crab/output/06b-trimgalore/trim-illumina-polyA/15-033_R1_001_val_1_val_1.fq.gz -2 /vortexfs1/scratch/yaamini.venkataraman/wc-green-crab/output/06b-trimgalore/trim-illumina-polyA/15-033_R2_001_val_2_val_2.fq.gz -o 15-033 –validateMappings -p 16 –validateMappings Version Server Response: Not Found (mapping-based mode) Exception : [option ‘–validateMappings’ cannot be specified more than once]. Please be sure you are passing correct options, and that you are running in the intended mode. alignment-based mode is detected and enabled via the ‘-a’ flag. Exiting. Error detected: Error, cmd: salmon quant -i /vortexfs1/scratch/yaamini.venkataraman/wc-green-crab/output/06c-trinity/trinity_out_dir/Trinity.fasta.salmon.idx -l ISR -1 /vortexfs1/scratch/yaamini.venkataraman/wc-green-crab/output/06b-trimgalore/trim-illumina-polyA/15-033_R1_001_val_1_val_1.fq.gz -2 /vortexfs1/scratch/yaamini.venkataraman/wc-green-crab/output/06b-trimgalore/trim-illumina-polyA/15-033_R2_001_val_2_val_2.fq.gz -o 15-033 –validateMappings -p 16 –validateMappings died with ret: 256 at /vortexfs1/home/yaamini.venkataraman/.conda/envs/trinity_env/bin//util/align_and_estimate_abundance.pl line 729.
It seems like validateMappings was specified twice in the command. When I look at my code, I did specify validateMappings:
# Perform transcript abundance estimation with salmon
${TRINITY}/util/align_and_estimate_abundance.pl \
--transcripts ${OUTPUT_DIR}/trinity_out_dir/Trinity.fasta \
--seqType fq \
--samples_file ${trinity_file_list} \
--SS_lib_type RF \
--est_method salmon \
--aln_method bowtie2 \
--gene_trans_map ${OUTPUT_DIR}/trinity_out_dir/Trinity.fasta.gene_trans_map \
--output_dir ${OUTPUT_DIR} \
--salmon_add_opts "--validateMappings " \
--thread_count 16
I removed the salmon_add_opts argument and reran the script. I checked on it a few minutes after it started running, and it’s at least progressed past where I last got the error message!
2026-01-27
The script completed! The salmon output consists of separate quantification matrices for each sample. There is a transcript-level abundance estimate file (quant.sf) and a gene-level abundance estimate file (quant.sf.genes):
(base) [yaamini.venkataraman@poseidon-l2 15-033]$ head quant.sf Name Length EffectiveLength TPM NumReads TRINITY_DN0_c0_g1_i11 236 64.198 0.765732 2.207 TRINITY_DN0_c0_g1_i12 274 88.733 4.922931 19.611 TRINITY_DN0_c0_g1_i13 221 55.186 0.743936 1.843 TRINITY_DN0_c0_g1_i2 274 88.733 2.695400 10.738 TRINITY_DN0_c0_g1_i4 243 68.488 75.481102 232.085 TRINITY_DN0_c0_g1_i5 227 58.786 0.000000 0.000 TRINITY_DN0_c0_g1_i6 294 102.724 0.386408 1.782 TRINITY_DN0_c0_g1_i7 252 74.062 0.000000 0.000 TRINITY_DN0_c0_g1_i8 380 170.289 0.490259 3.748
(base) [yaamini.venkataraman@poseidon-l2 15-033]$ head quant.sf.genes Name Length EffectiveLength TPM NumReads TRINITY_DN44545_c0_g1 247.00 70.94 0.00 0.00 TRINITY_DN77129_c3_g1 334.00 133.05 0.17 1.00 TRINITY_DN251898_c0_g1 208.00 47.91 0.00 0.00 TRINITY_DN4052_c0_g1 450.24 209.95 8.99 84.70 TRINITY_DN541168_c0_g1 264.00 82.05 0.00 0.00 TRINITY_DN322591_c0_g1 287.00 97.64 0.00 0.00 TRINITY_DN71650_c0_g1 2549.00 2321.84 0.00 0.00 TRINITY_DN2047_c12_g4 212.00 50.01 0.00 0.00 TRINITY_DN6870_c2_g1 1461.00 1233.84 4.99 276.59
I confirmed that these outputs looked equivalent to what I would expect based on the trinity manual. Now that I have this information, I need to build a matrix with all sample information and calculate ExN50 statistics. Looking at Zac’s code, it seems like he did all of this in two steps, just like the trinity manual suggests. I also dug into the trinity manual and wrote the followign code to get a matrix with all sample information:
# Get a list of the salmon quant.sf files so we don't have to list them individually
find ${OUTPUT_DIR}/ -maxdepth 2 -name "quant.sf" | tee ${OUTPUT_DIR}/salmon.quant_files.txt
# Generate a matrix with all abundance estimates
$TRINITY_HOME/util/abundance_estimates_to_matrix.pl \
--est_method salmon \
--gene_trans_map none \
--quant_files ${OUTPUT_DIR}/salmon.quant_files.txt \
--name_sample_by_basedir
This produced several output matrices, some normalized and some not normalized. For downstream DESeq2 applications, I need the raw counts. I checked Zac’s script and saw that he used the matrix without cross-normalized counts for Ex50 statistics. I did the same:
# Calculate Ex50 statistics
contig_ExN50_statistic.pl ${OUTPUT_DIR}/salmon.isoform.TPM.not_cross_norm \
${OUTPUT_DIR}/trinity_out_dir/Trinity.fasta \
| tee ${OUTPUT_DIR}/ExN50.stats
# Calculate N50 statistics
TrinityStats.pl ${OUTPUT_DIR}/trinity_out_dir/Trinity.fasta \
> ${OUTPUT_DIR}/N50.txt
That finished running pretty quickly and I got my Ex50 statistics! The E90N50 value is 1880, or ~1.9 kb. There are 30,741 genes that were used to contribute this value. This is much better than the N50 statistics.
Now that I have this value, I can move onto cleaning the transcriptome!
Going forward
- Clean transcriptome with
EnTapandblastn - Quantify transcripts with
salmon - Identify differentially expressed genes
- Additional strand-specific analysis in the supergene region
- Examine HOBO data from 2023 experiment
- Demographic data analysis for 2023 paper