Cold Acclimation Green Crab Experiment Part 2
Designing a restriction digest
It’s time to design primers! The current SMC primers yield a product that’s 126 bp. This small of a product can’t be used with a restriction enzyme digest. If a restriction enzyme cuts at any of the SNPs, the resultant products won’t really be distinguishable on a gel. It’s also possible that the really small product is what’s leading to all my contamination issues!
Primer design
To design the primers, I used Primer 3 Plus. I uploaded sequence for the SMC region Carolyn provided me. Then, I specified which SNP site I wanted to design primers for. I wanted a 500 bp window around the primers. I also messed around with some advanced settings based on suggestions from Sarah. I wanted a lower self complement (does the primer bind to itself) and pair complement (does the primer bind to the complementary primer) than the defaults:
Figure 1. Settings used for primer design.
For each SNP, I went through the first three primer pairs and recorded information like the distance from the primer to the SNP, % GC content (these are stronger bonds so they increase stability. 50-55% is ideal, 30-80% is good), primer length (18-30 bp is good), annealing temperatures (65ºC-75ºC is standard, and both the forward and reverse primers should have similar annealing temperatures).
Table 1. Various primer options for SNPs in the supergene region
| SNP | L Primer Start | L Distance to SNP (bp) | L Primer Length | L Primer (% GC) | R Primer Start | R Distance to SNP | R Primer Length | R Primer (% GC) | Product Size (bp) | Tm (L/R/Pair) | Self Complement Score (L/R/Pair) | Pair Complement Score (L/R/Pair) | Hairpin Structure Tm (ºC) | Self Structure Tm (ºC) |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 2265 (G/A) | 2239 | 26 | 25 | ACTGAGATCAAAAACAGTAAAGCCA (36%) | 2835 | 570 | 20 | GGCATCCTCTTCCATTCGCT (55%) | 597 | 59.2/60.2/84.5 | 0/0/0 | 0/0/0 | 41 (L) | N/A |
| 2265 (G/A) | 2231 | 34 | 26 | TGCAGAAAACTGAGATCAAAAACAGT (34.6%) | 2380 | 115 | 21 | CCTCTTCCATTCGCTCCATGA (52.4%) | 600 | 60.1/59.9/84.4 | 0/0/0 | 0/0/0 | 43.9 (L) | N/A |
| 2265 (G/A) | 2225 | 40 | 24 | CAGAAATGCAGAAAACTGAGATCA (37.5%) | 2824 | 559 | 20 | CCATTCGCTCCATGACTTCT (50%) | 600 | 57.8/57.7/84.3 | 0/0/0 | 0/0/0 | N/A | N/A |
| 3231 (A/C) | 3211 | 20 | 20 | AAGAAGCTTGCACCTCAGGG (55%) | 3758 | 527 | 27 | AGAGGAAATTTACAAAAAGGAAAAGCC (33.3%) | 548 | 60.3/59.3/84.3 | 2.1/2.6/0 | 0/0/0 | 38.9 (L) | 2.1 (L) |
| 3231 (A/C) | 3205 | 26 | 23 | GTGTTTAAGAAGCTTGCACCTCA (43.5%) | 3865 | 634 | 26 | ATTTACAATTTACACTGGAAGCATTC (30.8%) | 661 | 59.7/57/83.2 | 2.1/0/0 | 0/0/2.1 | N/A | 2.1 (L) |
| 3231 (A/C) | 3147 | 84 | 21 | CCGCAAATATGAAGCCATCCA (47.6%) | 3395 | 164 | 21 | TGTTACCTCAGGTCCCTCTCA (52.4%) | 849 | 59/59.6/82.6 | 0/0/0 | 0/0/0 | 34.4/37.1 (L/R) | N/A |
| 3528 (C/T) | 3474 | 219 | 20 | TGATGCTCAGCACAGGAAGG (55%) | 4163 | 635 | 27 | CTTCCATACTTTAACTTCATGAGAACA (33.3%) | 690 | 60/57.8/80 | 0/0/5.7 | 0/0/1.7 | 43 (L) | 5.7/1.7 (R, Pair/Self) |
| 3562 (C/T) | 3474 | 185 | 20 | TGATGCTCAGCACAGGAAGG (55%) | 4163 | 601 | 27 | CTTCCATACTTTAACTTCATGAGAACA (33.3%) | 690 | 60/57.8/80 | 0/0/5.7 | 0/0/1.7 | 43 (L) | 5.7/1.7 (R, Pair/Self) |
Carolyn then helped me evaluate the primers. The fourth primer in the table has runs of 3-4+ nucleotides, which she said to avoid due to slippage. Since I’m designing a restriction enzyme digest, I really want the distance from the primer to the SNP to be > 100 bp. This way, if I use the SNP as a cut site, I will end up with bands I can distinguish on the gel. Based on the above criteria, we decided to order the primer that was applicable for both C/T SNPs. If using the either C/T SNP as a cut site, I will have a ~700 bp product for one homozygote, one ~200 bp and one ~500 bp product for the other homozygote, and one 200 bp band, one 500 bp band, and one 700 bp band for a heterozygote.
Once I receive the primers, I can run PCR and confirm that my product length is roughly what I’d expect! There’s a chance that the product encompasses an intron-exon boundary. If this is the case, my product would end up much longer than expected since I’m designing using the transcriptome sequences. If this happens, I can sequence the PCR product and then design a better primer with a shorter product. While waiting for my primers, my next step is to determine if there’s a good restriction enzyme that encompass the C/T SNP cut sites.
Going forward
- Check temperature of tanks
- Identify candidate restriction enzymes for new primers
- Develop restriction band digest for genotyping
- Develop heart rate protocol